If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Department of Molecular Therapy, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Tokyo, JapanDepartment of Neurology, National Center Hospital, National Center of Neurology and Psychiatry, Tokyo, Japan
In vitro drug screening using urine-derived cells has high sensitivity to detect exon skipping.
•
The eteplirsen sequence showed lower exon skipping efficiency than other sequences in our system.
•
Our system enables the development of exon skipping drugs dependent on DMD mutation types.
Abstract
Exon skipping using short antisense oligonucleotides (AONs) is a promising treatment for Duchenne muscular dystrophy (DMD). Several exon-skipping drugs, including viltolarsen (NS-065/NCNP-01), have been approved worldwide. Immortalized human skeletal muscle cell lines, such as rhabdomyosarcoma cells, are frequently used to screen efficient oligonucleotide sequences. However, rhabdomyosarcoma cells do not recapitulate DMD pathophysiology as they express endogenous dystrophin. To overcome this limitation, we recently established a direct human somatic cell reprogramming technology and successfully developed a cellular skeletal muscle DMD model by using myogenic differentiation 1 (MYOD1)-transduced urine-derived cells (MYOD1-UDCs). Here, we compared in vitro drug screening systems in MYOD1-UDCs and rhabdomyosarcoma cells. We collected UDCs from patients with DMD amenable to exon 51 skipping, and obtained MYOD1-UDCs. We then compared the efficiency of exon 51 skipping induced by various morpholino-based AONs, including eteplirsen in differentiated MYOD1-UDCs (UDC-myotubes) and rhabdomyosarcoma cells. Exon skipping was induced more efficiently in UDC-myotubes than in rhabdomyosarcoma cells even at a low AON concentration (1 μM). Furthermore, exon 51 skipping efficiency was higher in UDC-myotubes with a deletion of exons 49–50 than in those with a deletion of exons 48–50, suggesting that the skipping efficiency may vary depending on the DMD mutation pattern. An essential finding of this study is that the sequence of eteplirsen consistently leads to much lower efficiency than other sequences. These findings underscore the importance of AON sequence optimization by our cellular system, which enables highly sensitive screening of exon skipping drugs that target different types of DMD mutations.
Duchenne muscular dystrophy (DMD) is a severe muscle disorder characterized by mutations in the DMD gene that disrupt the reading frame, leading to a lack of functional dystrophin [
]. Exon-skipping using short antisense oligonucleotides (AONs) is a promising treatment for DMD that aims to convert the more severe DMD phenotype into the milder Becker muscular dystrophy phenotype by altering pre-mRNA splicing and restoring the open reading frame [
Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study.
Entries in the Leiden Duchenne muscular dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule.
]. Theoretically, single and double exon skipping could be applicable to 79% of deletions, 73% of duplications, and 91% of small mutations, amounting to 83% of all DMD mutations [
]. Eteplirsen, a morpholino-based AON for exon 51 skipping, received accelerated approval from the United States Food and Drug Administration (FDA) in 2016, making it the first FDA-approved drug for treating DMD [
]. Recently, viltolarsen (NS-065/NCNP-01), a morpholino-based AON amenable to exon 53 skipping in DMD, has been approved in Japan (ClinicalTrials.gov: NCT02081625) [
]. In addition, there are a number of ongoing or planned studies targeting deletions amenable to skipping exons 44, 45, 51, and 53 worldwide (NCT02500381, NCT03218995, NCT03375255, NCT02310906, NCT02081625, NCT03508947, and NCT02667483).
Given that different patients have distinct mutations in the DMD gene, AON sequences need to be designed for each mutation type. Selection of therapeutically effective sequences is critical for clinical trial success. Screening for highly active sequences requires a great deal of effort and time. As an in vitro screening system, patient-derived primary skeletal muscle cells, which have an endogenous DMD phenotype, are often used [
Chimeric RNA/ethylene-bridged nucleic acids promote dystrophin expression in myocytes of Duchenne muscular dystrophy by inducing skipping of the nonsense mutation-encoding exon.
Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48–50 DMD cells.
] because dystrophin restoration can be detected following exon skipping. However, the limitations of using primary muscle cells are their limited proliferative capacity [
] and the need for invasive muscle biopsies. Another important limitation of primary muscle cells is that they are poorly differentiated, and the production of dystrophin protein is usually undetectable following exon skipping. To overcome these limitations, immortalized skeletal muscle cells have been used previously [
]. However, because rhabdomyosarcoma cells are a normal human myoblast model, the recovery of dystrophin levels cannot be evaluated as they express dystrophin endogenously. Therefore, an in vitro assay using rhabdomyosarcoma cells requires an additional procedure: the restored dystrophin expression levels after exon skipping by the candidate sequences should be confirmed in muscle cells with mutations in the DMD gene.
Therefore, the establishment of a new drug screening assay system using a DMD muscle model lacking dystrophin that has a high proliferative ability and can be collected non-invasively is required. In addition, the protocol should be simple, as it is necessary to create models with different types of DMD gene mutations. Currently, there is a growing interest in the potential application of non-invasively obtained urine-derived cells (UDCs) in the in vitro models of genetic diseases [
]. Two great works published in 2016 showed that UDCs could be reprogrammed into myogenic cells through viral delivery of the muscle transcription factor MYOD1, thus creating a DMD skeletal muscle model [
]. The most significant limitation of previous reports is the insufficient direct-reprogramming efficiency of UDCs into myotubes as an ideal muscle model of DMD. To overcome some of the challenges mentioned above, we recently reported efficient cellular skeletal muscle modeling of DMD by using MYOD1-UDCs obtained from patients with DMD [
]. Since the DMD skeletal muscle model could be induced efficiently in a short period of time and the protocol is straightforward, we expected this to be a new screening system for therapeutic agents instead of using rhabdomyosarcoma cells.
The purpose of this study was to investigate whether the conventional system using rhabdomyosarcoma cells could be replaced with an in vitro drug screening system using UDCs. To that end, we investigated whether sufficient numbers of UDCs could be obtained for screening and whether treatment with various sequences of AON could detect dose-dependent exon skipping in UDCs. Because the most common patients with DMD eligible for exon skipping were those with a mutation amenable to skipping exon 51, we used UDCs from them in the present study.
2. Materials and methods
2.1 Ethics statement
This study was approved by the Ethics Committee of the National Center of Neurology and Psychiatry (approval ID: A2018–029). All individuals gave informed consent before providing urine samples. All experiments were performed in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki).
2.2 Cell culture
Rhabdomyosarcoma cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum on polyethene-coated plates at 37 °C in a humidified atmosphere of 95% air and 5% CO2.
Normal human myoblasts were cultured in DMEM/F12 containing 20% fetal bovine serum on gelatin-coated plates. For passage, the cells were dissociated by treatment with 0.25% trypsin-EDTA before 50%–70% confluence and seeded at 3500 cells/cm2. For myogenic differentiation, myoblasts were seeded at 2.5 × 104/cm2 on gelatin-coated plates. The next day, the medium was changed to DMEM/F12 containing 2% horse serum. Four or 5 days after differentiation, myoblasts fused and formed multinucleated myotubes.
UDCs are a mixed population of either uroepithelial or renal epithelial cells expressing most mesenchymal stem cells and peripheral cell markers [
]. Briefly, whole urine samples were centrifuged at 400 ×g for 10 min at room temperature. The cell pellet was resuspended in the primary medium composed of a 1:1 mixture of DMEM (GE Healthcare, Logan, UT) and Ham's F-12 Nutrient Mix (Thermo Fisher Scientific, Waltham, MA) supplemented with renal epithelial cell growth medium (REGM) SingleQuots (Lonza, Basel, Switzerland), 10% tetracycline-free fetal bovine serum, 1% penicillin/streptomycin, and 0.5 μg/mL amphotericin B. Cells were seeded in gelatin-coated plates and cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2 for 3 days. On day 4, the medium was replaced with growth medium comprising a 1:1 mixture of DMEM and REGM Bullet Kit (Lonza) supplemented with 15% tetracycline-free fetal bovine serum, 0.5% non-essential amino acids (Thermo Fisher Scientific), 0.5% Glutamax (Thermo Fisher Scientific), 2.5 ng/mL of fibroblast growth factor-basic (Sigma, St Louis, USA), platelet-derived growth factor (Peprotech, Rocky Hill, NJ), epidermal growth factor (Peprotech), and 1% penicillin/streptomycin. The growth medium was changed every other day.
2.3 Myogenic differentiation of MYOD1-transduced UDCs
According to our previous report, we performed direct reprogramming of UDCs into myotubes [
]. In short, we transduced MYOD1 into patient-derived UDCs by a retroviral vector containing a doxycycline-inducible MYOD1 expression system, and differentiated MYOD1-transduced UDCs (MYOD1-UDCs) into myotubes by changing the growth medium to differentiation medium containing doxycycline and 5 μM 3-deazaneplanocin A hydrochloride. After 3 days, the differentiation medium was replaced with fresh differentiation medium without 3-deazaneplanocin A. Thereafter, the medium was changed every 3 days. As a result, MYOD1-UDCs stopped proliferating and fused, forming UDC-myotubes 1 week after the start of differentiation.
2.4 AON transfection
For electroporation, green fluorescent protein (GFP) plasmid or AONs were dissolved in distilled water and transfected into the target cells using Nucleofector® (Lonza, Basel, Switzerland) with program settings according to the manufacturer's instructions. To transfect AONs into the target cells using Endo-Porter transfection reagent (Gene Tools, Philomath, OR, USA), a mixture of AONs, Endo-Porter, and culture medium was prepared with a final AON concentration of 1–20 μM. Transfection and subsequent culturing were performed at 37 °C in a humidified atmosphere of 95% air and 5% CO2. After 3 days of incubation with AON, the medium was changed to fresh differentiation medium without AON.
2.5 RNA analysis
For reverse transcription-polymerase chain reaction (RT-PCR) analysis, the cells were lysed, and RNA was harvested using an RNeasy kit (Qiagen, Hilden, Germany). One microgram of total RNA was used as a template for RT-PCR with cDNA reverse transcription kits (Applied Biosystems, Warrington, UK). For one RT-PCR reaction, 1 μL of cDNA template was mixed with 14.9 μL of water, 1.6 μL of 2.5 mM deoxynucleotide triphosphates (dNTPs), 2 μL of 10× Ex Taq Buffer, 0.1 μL Ex Taq HS from an Ex Taq Hot Start Version kit (Takara Bio, Shiga, Japan), 0.2 μL of 10 μM forward primer, and 0.2 μL of 10 μM reverse primer. The primer sequences are shown in Table 1 and the Supplementary Table. The cycling conditions were 95 °C for 4 min; 35 cycles of 94 °C for 30 s, 55–60 °C for 30 s, and 72 °C for 1 min; and finally, 72 °C for 4 min. PCR products were detected using MultiNA, a microchip electrophoresis system (Shimadzu, Kyoto, Japan). Exon-skipping efficiency (%) was calculated as (PCR product without exon 51)/(total primer-specific PCR products) × 100% using MultiNA.
Table 1Mutation patterns in DMD patients and dystrophin primers used for RT-PCR.
Subjects
Age (years)
DMD exon deletion
Target exon for skipping
Primers for dystrophin mRNA used in RT-PCR (5′ to 3′)
]. Briefly, total protein was extracted from cultured cells using radio immunoprecipitation assay (RIPA) buffer containing protease inhibitors (Roche, Indianapolis, IN, USA). The lysates were sonicated on ice and centrifuged at 14,000 ×g for 15 min at 4 °C. The supernatant was collected, and protein concentrations were measured using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific). After mixing with NuPAGE LDS sample buffer (Thermo Fisher Scientific), cell lysates were denatured at 70 °C for 10 min, electrophoresed at 150 V for 75 min using NuPAGE Novex Tris-Acetate Gel 3%–8% (Invitrogen), and then transferred to polyvinylidene fluoride membranes. The membranes were incubated with the primary antibodies, followed by incubation with the secondary antibody using an iBind Flex Western Device (Thermo Fisher Scientific). The primary antibodies used were rabbit anti-dystrophin (1:500, Abcam, Cambridge, UK; ab15277) and mouse anti-α-tubulin (1:1000, Sigma; T6199). Histofine Simple Stain MAX-PO (1:100, NICHIREI BIOSCIENCE INC., Tokyo, Japan; 424,151) was used as the secondary antibody. Proteins were detected using the ECL Prime Western Blotting detection reagent (GE Healthcare, UK; RPN2232) and a ChemiDoc MP imaging system (Bio-Rad, Hercules, CA, USA). Data were analyzed using Image Lab 6.0 (Bio-Rad).
3. Results
3.1 MYOD1-UDCs obtained from patients with DMD have high proliferative ability
Drug screening for DMD should be performed in cells that have a high proliferative ability, which would ensure large cell numbers. We compared the proliferative properties of UDCs, rhabdomyosarcoma cells, and normal human myoblasts. Before that, we collected urine from three patients with DMD (DMD_1, DMD_2, and DMD_3 with deletions of exons 45–50, 48–50, and 49–50, respectively) (Table 1), isolated UDCs, and transduced MYOD1 into UDCs to obtain MYOD1-UDCs. Then, the number of cells of each type was counted at each passage. We observed that UDCs had a higher proliferative ability before and after transduction with MYOD1 compared with rhabdomyosarcoma cells and normal human myoblasts (Fig. 1).
Fig. 1Proliferation curves of urine-derived cells (UDCs) from patients with DMD before and after MYOD1 transduction, rhabdomyosarcoma cells, and normal human myoblasts. Cell count was initiated at the 4th passage as day 0. Data are presented as the mean ± SEM. MYOD1-UDCs: MYOD1-transduced urine-derived cells.
3.2 Exon skipping in differentiated MYOD1-transduced UDCs (UDC-myotubes) from patients with DMD using various AONs
Exon skipping induction efficiency could be significantly affected by the type of cells used for the assay. Therefore, to investigate whether the induction of exon skipping occurred in UDC-myotubes, rhabdomyosarcoma cells, or human skeletal myoblasts, we performed exon skipping using various AONs in all these cell types.
Before the exon skipping experiment, we optimized the transfection of AONs into target cells by comparing the typical transfection methods, including electroporation and reagent-based transfection. In our study, the conditions to be met by the electroporation method were that the target cells could survive after electroporation and were properly punctured such that morpholino could pass through. Therefore, as a simple method to confirm that these conditions were met, we observed the cell viability and fluorescence signal intensity after electroporation experiments using the GFP plasmid. We transfected GFP plasmid into target cells by several Nucleofector® programs and evaluated transfection efficiency and cell viability the next day. We established that the pre-loaded electroporation programs T-020, T-030, and A-033 were the most optimal for MYOD1-UDCs, rhabdomyosarcoma cells, and normal myoblasts, respectively (Supplementary Fig. 1). Next, AON for skipping exon 51 was transfected into target cells using the best electroporation programs mentioned above and Endo-Porter®, a frequently used transfection reagent. Thereafter, total RNA was extracted, and exon skipping efficiency was calculated by performing RT-PCR. Based on exon skipping efficiency results, the optimal transfection methods for MYOD1-UDCs, rhabdomyosarcoma cells, and myoblasts were as follows: Endo-Porter, electroporation (T-030 program), and electroporation (A-033 program), respectively (Supplementary Fig. 2).
Next, we directly reprogrammed UDCs obtained from three patients with DMD: DMD_1, DMD_2, and DMD_3 with deletions of exons 45–50, 48–50, and 49–50, respectively (Table 1), into myotubes (UDCs-myotubes) according to the steps described in our previous report [
]. As a result, UDCs derived from all patients with DMD morphologically formed multinucleated myotubes (Supplementary Fig. 3A) and expressed muscle-specific genes, including those encoding myogenin, α-actinin, desmin, and MYH3, although primary UDCs hardly expressed any of those genes (Supplementary Fig. 3B). Thereafter, exon skipping was performed in the UDC-myotubes derived from the three patients with DMD, rhabdomyosarcoma cells, and normal human myoblasts. Four AONs (Ete-10, Ete, Ete+10, and E51Ac as shown in Table 2) targeting exon 51 were transfected into each cell type using the optimized method described above with the final concentrations of 1–20 μM. Dose-dependent exon skipping was observed after treatment with AONs regardless of the cell type (Fig. 2A ). Moreover, we found that UDC-myotubes detected exon skipping with higher sensitivity than rhabdomyosarcoma cells when the final AON concentration was low (1 μM; Fig. 2B). On the other hand, when AON was transfected at a final concentration of 5 or 20 μM, the induction of exon skipping in UDC-myotubes achieved saturation. Scatter plots of exon skipping efficiencies induced by each AON in the three cell types did not represent a straight line. Specifically, the change in skipping efficiency was larger in UDC-myotubes than in rhabdomyosarcoma cells or normal human myoblasts when the concentration of AONs was low (Fig. 2C, D).
Table 2Characteristics of AONs used in this study.
Name of AON
Position to form complementary strand to exon 51 of DMD
AON sequence (5′ to 3′)
Length (bp)
References
Ete-10
+56 + 85
AAGGAAGATGGCATTTCTAGTTTGGAGATG
30
None
Ete-5
+61 + 90
ACATCAAGGAAGATGGCATTTCTAGTTTGG
Ete
+66 + 95
CTCCAACATCAAGGAAGATGGCATTTCTAG
Cirak, S.et al.Lancet, 2011
Ete+5
+71 + 100
AATGCC ATCTTCCTTG ATGTTGGAGG TACC
None
Ete+10
+76 + 105
GAGCAGGTACCTCCAACATCAAGGAAGATG
E51Ac
+0 + 29
GTGTCACCAGAGTAACAGTCTGAGTAGGAG
Echigoya, Y. et al. Mol Ther, 2017
Ete. indicates Eteplirsen. Ete-10 indicates the sequence starting 10 bp upstream of Eteplirsen. Ac indicates acceptor site of exon 51. +56 + 85 indicates that AON forms a complementary strand with the region from base 56 to base 85 of exon 51 in pre-mRNA.
Fig. 2Screening of antisense oligonucleotides (AONs) for exon-skipping in differentiated MYOD1-transduced urine-derived cells (UDC-myotubes) from patients with DMD, rhabdomyosarcoma cells, and normal human myoblasts. (A) RT-PCR analysis of dystrophin expression after treatment with various AONs (final concentrations: 1, 5, and 20 μM) in UDC-myotubes derived from three patients with DMD (DMD_1, DMD_2, and DMD_3) with deletions of exons 45–50, 48–50, and 49–50, respectively, rhabdomyosarcoma cells, and normal human myoblasts. Representative images are shown. Deletions of exons 45–50, 48–50, and 49–50 were restored in-frame by skipping exon 51. The “native” bands are unskipped products. (B) Quantification of exon-skipping after treatment with AONs evaluated by RT-PCR shown in (A). Skipping efficiency data for UDC-myotubes (left), rhabdomyosarcoma cells (middle), and normal human myoblasts (right) are shown. Skipping efficiency was calculated as (PCR product without exon 51) / (total primer-specific PCR products) × 100%. One-way analysis of variance (ANOVA) followed by the Tukey's post hoc test was used to compare skipping efficiencies. Data are expressed as the mean ± SEM (n = 3 for each group; *P < 0.05). (C, D) Scatter diagram of skipping efficiency values in UDC-myotubes, rhabdomyosarcoma cells, or normal human myoblasts, respectively. Ex: exons of the DMD gene. Ete: eteplirsen. Ete-10: the sequence starting 10 bp upstream of eteplirsen. E51Ac: the sequence starting at the acceptor site sequence of exon 51.
These data show that UDC-myotubes report the induction of exon skipping after AON treatment as efficiently as rhabdomyosarcoma cells and normal human myoblasts. Furthermore, UDC-myotubes detect exon skipping with higher sensitivity when the concentration of AONs is low.
3.3 Relationship between exon skipping efficiency and restored dystrophin expression in UDC-myotubes
The goal of exon skipping therapy is to restore the open reading frame of dystrophin mRNA to produce short but functional dystrophin, which leads to the recovery of muscle weakness. Therefore, to examine whether the level of exon skipped mRNA in UDC-myotubes correlated with the recovery of dystrophin protein amount, the UDC-myotubes derived from DMD_1 with exon 45–50 deletion were treated with several AONs (Ete-10, Ete-5, Ete, Ete+5, Ete+10, and E51Ac; Table 2). Total RNA and protein were extracted 1 and 2 weeks after AON treatment, respectively, and RT-PCR for dystrophin mRNA and immunoblotting for dystrophin protein with an anti-dystrophin antibody were performed. As a result, we detected exon 51-skipped dystrophin mRNA and restored protein expression in a dose-dependent manner (Fig. 3A, B ). Moreover, exon skipping efficiency after AON treatment correlated well with the restored dystrophin's relative signal intensity (Fig. 3C).
Fig. 3Detection of restored dystrophin expression after treatment with antisense oligonucleotides (AONs) in differentiated MYOD1-transduced urine-derived cells (UDC-myotubes) from patient with DMD. (A) RT-PCR analysis of dystrophin expression after treatment with various AONs (final concentrations: 1, 5, and 20 μM) in UDC-myotubes derived from a DMD patient with a deletion of exons 45–50 in the DMD gene (DMD_1). (B) Immunoblotting analysis for dystrophin (upper) and α-tubulin (lower) in UDC-myotubes from patient DMD_1 after treatment with AONs as described in (A). An anti-α-tubulin antibody was used as a loading control. (C) Scatter diagram of skipping efficiency shown in (A) and relative signal intensity shown in (B). Relative signal intensity was calculated as (signal intensity of dystrophin band)/(signal intensity of α-tubulin band). Ex: exon of the DMD gene. Ete: eteplirsen. Ete-10: the sequence starting 10 bp upstream of eteplirsen. E51Ac: the sequence starting at the acceptor site sequence of exon 51.
3.4 Exon skipping in UDC-myotubes from patients with DMD with different DMD mutations
We compared the efficiency of exon skipping induced by the AON eteplirsen in UDC-myotubes derived from patients with DMD with deletions of exons 49–50 (patients DMD_3–5) or 48–50 (patients DMD_2, DMD_6, and DMD_7) (Table 1). Eteplirsen, which induces exon 51 skipping, was used at the final concentrations of 1–10 μM. As a result, exon skipping was induced in a dose-dependent manner in UDC-myotubes obtained from all six patients with DMD (Fig. 4A ). Furthermore, at a lower eteplirsen concentration of 1 μM, skipping efficiency was higher in UDC-myotubes with the deletion of exons 49–50 than in those with the deletion of exons 48–50 (Fig. 4B). These data indicate that the exon skipping treatment response may vary depending on the type of DMD mutation.
Fig. 4Comparison of exon skipping efficiency values in differentiated MYOD1-transduced urine-derived cells (UDC-myotubes) from patients with DMD with deletions of exons 48–50 and 49–50 in the DMD gene. (A) RT-PCR analysis of dystrophin mRNA expression after treatment with eteplirsen (final concentrations: 1, 5, and 10 μM) in UDC-myotubes derived from patients with DMD with deletions of exons 48–50 (upper) and 49–50 (lower). Both deletions were restored in-frame by skipping exon 51. (B) Quantification of exon-skipping after treatment with Ete evaluated by RT-PCR shown in (A). Skipping efficiency was calculated as (PCR product without exon 51)/(total primer-specific PCR products) × 100%. Data are presented as the mean ± SEM from three independent biological replicates (*P < 0.05). The Student's t-test was used to compare skipping efficiencies for each concentration of AONs. Ex: exon of the DMD gene. Ete: eteplirsen.
Antisense oligonucleotide therapeutics, including exon skipping drugs, need to be designed for each targeted exon, depending on each DMD mutation's identity. Therefore, it is preferable for antisense sequence screening to use primary cells obtained from patients with DMD to assess dystrophin restoration levels following exon skipping. Moreover, a non-invasive procedure that can readily obtain cells in sufficient quantity is desirable; thus, high proliferation ability of the cells is crucial. To meet these requirements, here, we describe a useful cellular system for sequence selection using MYOD1 converted UDC-myotubes derived from seven patients with DMD instead of using rhabdomyosarcoma cells.
Since the overexpression of MYOD1, myoblast determination protein 1, causes UDCs to exit the cell cycle and to terminally differentiate into MYOD1 converted UDC-myotubes, an inducible Tet-On retroviral delivery vector was used to control the timing and magnitude of MYOD1 expression [
]. Before MYOD1 was activated by doxycycline, the proliferative capacity of MYOD1-UDCs was extremely high, and a sufficient quantity of MYOD1-UDCs was obtained (Fig. 1). Given that MYOD1-UDCs could be stored in liquid nitrogen, we could utilize the cellular system at any time when needed. Exon skipping was equally evaluated in UDC-myotubes derived from three patients with DMD and rhabdomyosarcoma cells. However, exon skipping was notably detected with higher sensitivity in UDC-myotubes than in rhabdomyosarcoma cells at lower AON concentrations (Fig. 2).
Recently, eteplirsen, golodirsen, and viltralsen AONs for DMD exons 51 and 53 skipping, have been approved in the USA and Japan. Although promising, the efficacy of the employed eteplirsen and AON sequence remains controversial, with insufficient evidence of its therapeutic effect in patients. An essential finding of this study is that the eteplirsen sequence consistently leads to much lower skipping efficiency than other AON sequences. These findings underscore the importance of selecting optimal sequences through comprehensive AON screening for success in clinical trials.
In phase 1 of the open-label, dose-escalation clinical trial of viltolarsen, 10 patients with DMD were divided into low-dose (1.25 mg/kg body weight), medium-dose (5 mg), and high-dose (20 mg) cohorts [
]. The exon skipping efficiencies calculated by RT-PCR using skeletal muscle tissue after exon skipping treatment was less than 10% in most cases, after 12 times weekly injections of viltolarsen. Therefore, concentrations of AONs in skeletal muscle cells are expected to be low in clinical trials. To continue the development of AONs, it is desirable to establish a highly sensitive in vitro assay system capable of detecting highly efficient antisense sequences even at low concentrations. This would allow the selection of new AON drugs with reduced toxicity. In the present study, the exon skipping detection sensitivity of UDC-myotubes was higher than that of rhabdomyosarcoma cells. The reason may be that AONs were transfected into UDC-myotubes with higher efficiency than into rhabdomyosarcoma cells in our experiments. Another possible reason for the higher sensitivity of UDC-myotubes is the degradation of out-of-frame mRNAs due to nonsense-mediated mRNA decay after exon skipping in rhabdomyosarcoma cells, which would result in low exon skipping efficiency.
We have shown that exon skipping in UDC-myotubes after AON treatment might differ depending on DMD mutation patterns. It is well known that there are some dystrophin-positive fibers, named “revertant fibers,” present in low amounts (up to 10%) in muscles affected by DMD [
Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion.
]. Because exon skipping regulates DMD pre-mRNA splicing, different DMD mutations may lead to variable responses to exon skipping treatments. It is necessary to investigate the detailed mechanisms of such differential responses in vitro and to examine the relationship between the DMD mutation type and therapeutic effect of AONs in clinical trials. When AON is administered systemically via intravenous injection, serum AON levels' variability might have a more significant effect than DMD mutation differences. However, the importance of screening for sequences with high exon skipping efficiency should not be compromised for the development of exon skipping therapy.
We propose selecting lead antisense sequences to develop specific exon skipping drugs for various DMD mutations efficiently based on the findings. First, candidate sequences were selected by in silico analysis, and then, effective sequences were screened in an in vitro assay system using UDC-myotubes derived from patients with DMD. This new screening system enables us to obtain a large number of cells from patients with DMD non-invasively and repeatedly, and to evaluate the therapeutic effect of AONs on each targeted exon (Table 3). Although this assay system requires UDCs to be directly reprogrammed into myotubes, the protocol is straightforward, sophisticated, and stable.
Table 3Comparison of new and conventional in vitro drug screening assay systems. We can use these systems to confirm the activity of drug candidate compounds after in silico screening for drug discovery.
Our antisense screening system should aid the efficient development of exon skipping drugs and potentially lead to the creation of therapeutics specific for different types of DMD mutations.
Acknowledgments
All authors read and approved the final version of the manuscript. All authors have read the journal's policy on conflicts of interest. The National Center of Neurology and Psychiatry is now developing Viltolarsen (NS-065/NCNP-01), an exon 53 skipping drug for DMD with the Nippon Shinyaku Co., Ltd. This work was supported by the Japanese Society for the Promotion of Science Grant-in-Aid for Scientific Research (C) [grant number 18K07544 to Y. A.], Grants-in-Aid for Research on Nervous and Mental Disorders [grant numbers 28–6 and 2–6 to Y. A.], and the Japan Agency for Medical Research and Development [grant numbers 19ek0109239h0003, and 19lm0203069h0002 to Y. A.]. We would like to thank Editage (www.editage.com) for English language editing. There are no conflicts of interest to declare.
Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study.
Entries in the Leiden Duchenne muscular dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule.
Chimeric RNA/ethylene-bridged nucleic acids promote dystrophin expression in myocytes of Duchenne muscular dystrophy by inducing skipping of the nonsense mutation-encoding exon.
Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48–50 DMD cells.
Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion.
00030-7&id=gr1.jpg){kind=link}
00030-7&id=gr2.jpg){kind=link}
00030-7&id=gr3.jpg){kind=link}
00030-7&id=gr4.jpg){kind=link}